Save this Search
     

All JobsIT & Programming

 9,736 results  
Sort by:
  • Posted Date
Fixed Price: Less than $500   |  Posted: 22 minutes ago  |  Ends: 14d, 23h  |   0 Proposals
I need a very simple APP built in both Android and iOS. What this app will do is that it will load a list of radio station and the corresponding US phone number for these stations. These stations may be updatable from time to time. So, there will be : Country, Station Name, Short Description, and Number This information is available via a PHP restful interface. The APP will pre-load with list and when it gets online it will refresh the new list. The Country will be defaulted to Chinese the first time and then it will be saved until the user changes it. There is a few pages: 1 - Main Page telling people what this App does 2 - List of station people can view, they can see the short description, and phone number 3 - They can click Dial and the APP will make the call using the phone's normal phone service to make the call to listen to the radio station. Your job will include: - Design of the UI - Putting the APP in both APP store and iOS Store
Category: Mobile Applications       
Skills: Android, iPhone, iPad       

p****dao
 [?]
Sign in to view client's details.
| p****dao
|    China
Fixed Price: Less than $500   |  Posted: 25 minutes ago  |  Ends: 14d, 23h  |   0 Proposals
I have an HTML table that needs to be styled responsively. There is one other div that needs some work done to it but not much. This needs to be styled in HTML and then transported over to Wordpress and HTML.
Category: Website Design       
Skills: PHP, CSS3       

F****n07
 [?]
Sign in to view client's details.
| F****n07
|    United States
Fixed Price: Not Sure   |  Posted: 28 minutes ago  |  Ends: 14d, 23h  |   0 Proposals
Have a single page parallax theme based site which needs to be transferred to a more robust wp theme/site builder. Design also needs a creative designer to be enhanced graphically.
Category: Website Design       
Preferred Location: North America, India/Southern Asia, Central & South America

s****ro1
 [?]
Sign in to view client's details.
| s****ro1
Fixed Price: Less than $500   |  Posted: 31 minutes ago  |  Ends: 14d, 23h  |   0 Proposals
1) Need Ruby on Rail video tutorial to be hosted on my company website. 2) Video should be in SWF format. 3) Trainer will needs to cover all Ruby on Rail Basics 4) Trainer should also have good communication and presentation skills. 5) Along with bidding please also share a 2-3 min demo tutorial video to evaluate your skills.
Category: Web Programming       
Skills: Ruby on Rails, Ruby       

v****121
 [?]
Sign in to view client's details.
| v****121
|    United States
Fixed Price: Less than $500   |  Posted: 32 minutes ago  |  Ends: 14d, 23h  |   0 Proposals
You can see Facetune to see what effects and fuctions look like, I need you create app with all this effects and functions Job Description: Your responsibilities: - Review business requirements working with other team members - Perform a technical analysis of requirements - Produce a solid, detailed technical design - Write clean, modular, robust code to implement the desired requirements with little or no supervision - Work with the QA and Customer Support teams to triage and fix bugs with rapid turnaround - Contribute ideas for making the application better and easier to use Your qualifications: - A work style that is extremely detail oriented - Strong communication skills - A complete Elance profile - References or an established Elance reputation preferred
Category: Mobile Applications       
Skills: iPhone, Mobile Programming, iPad, iOS       

h****yba
 [?]
Sign in to view client's details.
| h****yba
|    Vietnam
Fixed Price: Less than $500   |  Posted: 32 minutes ago  |  Ends: 14d, 23h  |   0 Proposals
Hello, We recently created a site in wordpress and just recently we noticed that users are getting a warning using Google Chrome browswer indicating website has malware. Please take a look at   [obscured]  /gift-certificates/ and start to make a payment in Google Chrome to see message.
Category: Web Programming       
Skills: MySQL Administration, Javascript, PHP       

n****sol
 [?]
Sign in to view client's details.
| n****sol
|    United States
Hourly Rate: Not Sure   |  Duration: Not Sure  |  Posted: 32 minutes ago  |  Ends: 1d, 23h  |   0 Proposals
I require the conversion of two pages to HTML. The requirements are: * 2 HTML pages created based on the attached mockups * pages need to render correctly at 1920x1080. They will be displayed full screen. * if it was a responsive design and scaled to work on smaller displays, that would be a bonus (optional - the 1920x1080 display is the most important) Mockups will be provided as a .pptx with editable layers.
Category: Web Programming       
Skills: CSS, HTML       

S****Box
 [?]
Sign in to view client's details.
| S****Box
|    Australia
Hourly Rate: $30 - $40 / hr   |  Duration: 1-3 months  |  Posted: 32 minutes ago  |  Ends: 14d, 23h  |   1 Proposal
Hello, freelancers I'm looking for 2~3 iOS Top Expert working with me. I have an project iOS app to backup and restore for all content within iOS device. Currently I already developed app on Windows PC. I want iOS app to achieve full function as Windows PC app. This app isn't common technology and needs special technology for iOS device and kernel. One thing clear is that it is possible all. Perhaps amount pays very well out of your imagination. If you are common iOS application developer such as social / erp / facebook etc, don't bid. Please bid only developer having experiences about this part. App's function for backup and restore like as following. 1. Camera roll 2. Contact 3. SMS 4. Calendar 5. Photos 6. Note 7. Video and Music If you have interesting about this project, please answer my question. Do you have experience saving and deleting from camera roll? This question will be valid for only 3 days. Best Regards
Category: Mobile Applications       
Skills: Android, iPhone, iOS       

L****211
 [?]
Sign in to view client's details.
| L****211
|    China
Fixed Price: $500 - $1,000   |  Posted: 33 minutes ago  |  Ends: 14d, 23h  |   0 Proposals
I need someone who is very experienced in coding to create a feature rich, nice looking mobile app. It a game where the character has to evade obstacles in a 2-D world. Requirements : -someone who can not only program but can also do the UI design -someone who has at least 300 hours on Odesk -someone who has five star rating -someone who takes pride in their work and makes polished looking products - speaking English well Basic ui designs, design typing objective-c, c programing, iphone, corona. Cocoa Please reply with example of your previous work lecturing any user interface or design example you have done before. If I like your previous work I will reply wand give more details.
Category: Mobile Applications       
Skills: Android, iPhone, iPad       

n****g59
 [?]
Sign in to view client's details.
| n****g59
|    Canada
Fixed Price: Less than $500   |  Posted: 35 minutes ago  |  Ends: 14d, 23h  |   0 Proposals
1) Need HTML video tutorial to be hosted on my company website. 2) Video should be in SWF format. 3) Trainer will needs to cover all HTML Basics 4) Trainer should also have good communication and presentation skills. 5) Along with bidding please also share a 2-3 min demo tutorial video to evaluate your skills.
Category: Web Programming       
Skills: HTML       

v****121
 [?]
Sign in to view client's details.
| v****121
|    United States
Fixed Price: $20 - $35   |  Posted: 35 minutes ago  |  Ends: 14d, 23h  |   1 Proposal
Human DNA is a molecule that encodes the genetic instructions used in the development and functioning of the human body. We don't want to make this a biology course, but let's cut to the chase. Each strand is composed of a sequence of guanine (g), adenine (a), thymine (t), and cytosine (c). Researchers have sequenced the entire human genome and have published the results online in various places. What we want to do is look for patterns in portions of the dna information, So for example, and to make it extremely simple. Here is a very small portion of human chromosome 1: gaattctttcatggttaaaatatcctaagagaagtaacacttctgctcccttcccactcc what we want our program to do is read in this portion, and then tell us how many times a user specified pattern occurs, and where each occurrence is within the portion of chromosome 1 being considered. The project is going to be divided into two phases. The first will deal with getting the struct setup and being able to search for a smaller str...
Category: Other IT & Programming       
Skills: C       

w****ho7
 [?]
Sign in to view client's details.
| w****ho7
|    United States
Fixed Price: Less than $500   |  Posted: 35 minutes ago  |  Ends: 14d, 23h  |   0 Proposals
Hello, The Cook County Clerk has a website that displays docket info:   [obscured]  /?section=CASEINFOPage&CASEINFOPage=2400 I would like to be able to search by date, and have the info from each docket number for that date put into a spreadsheet listing the: 1. Docket # 2. Case Type 3. District 4. Party Names 5. Attorney(s) With this script, I can plug my variable (date) into excel, and it will go off an grab my data. This is a return of the list by date:   [obscured]  /cookcounty/FindDock.asp?NCase=2013-D-08%23%23%23%23&SearchType=1&Database=4&case_no=&PLtype=1&sname=&CDate=09%2F10%2F2013 Then it will need to go into each result to retrieve the above data:   [obscured]  /cookcounty/Finddock.asp?DocketKey=CABDDAAIABA0DR I have the code for the macro that works for 2010 down, just need it to work for 365/2013
Category: Web Programming       
Skills: Microsoft Excel, Web Programming, ASP       

c****oy1
 [?]
Sign in to view client's details.
| c****oy1
|    United States
Fixed Price: Less than $500   |  Posted: 37 minutes ago  |  Ends: 14d, 23h  |   1 Proposal
1) Need PHP video tutorial to be hosted on my company website. 2) Video should be in SWF format. 3) Trainer will needs to cover all basic PHP topics 4) Trainer should also have good communication and presentation skills. 5) Along with bidding please also share a 2-3 min demo tutorial video to evaluate your skills.
Category: Other IT & Programming       
Skills: PHP       

v****121
 [?]
Sign in to view client's details.
| v****121
|    United States
Fixed Price: Not Sure   |  Posted: 38 minutes ago  |  Ends: 14d, 23h  |   0 Proposals
I have a row of thumbnail images. If the thumb is active, I give it an active class. All other thumbs have an inactive class. If i then click on another thumb, i want the active class to switch to that thumb and the previous active class to change to inactive. I would also like if a thumb is currently in an inactive state, to have a hover action on it fading its transparency. I can provide you with the testbed code on reply- this should take someone with js expertise a few minutes to fix for me.
Category: Web Programming       
Skills: MySQL Administration, Javascript, PHP       

d****nen
 [?]
Sign in to view client's details.
| d****nen
|    United States
Hourly Rate: $20 - $30 / hr   |  Duration: 1-3 months  |  Posted: 40 minutes ago  |  Ends: 2d, 23h  |   0 Proposals
This job is to provide ongoing tutoring services for DirectX 11 and C++. Total hours will vary but the first 2 weeks will be daily tutoring with 1-2 hours each day including weekends if possible. The tutoring will be for someone with software development experience but no experience with DirectX and a little experience with C++. Hours will be between 7PM and 11PM Central Standard Time. Duration will be 1-3 months. Topics covered range from basic DirectX 11 project setup using Visual Studio 2013 to more advanced concepts such as networking, database integration and streaming animated interactive DirectX output. Sessions will be done via Skype or any other available web conference system.
Category: Software Application       
Preferred Location: North America

c****ron
 [?]
Sign in to view client's details.
| c****ron
|    United States
Fixed Price: $50 - $175   |  Posted: 41 minutes ago  |  Ends: 14d, 23h  |   1 Proposal
Hello, The Cook County Clerk has a website that displays docket info:   [obscured]  /?section=CASEINFOPage&CASEINFOPage=2400 I would like a vb.net form to add to my project that will allow me to to search by date, and have the info from each docket number for that date put into a table listing the: 1. Docket # 2. Case Type 3. District 4. Party Names 5. Attorney(s) With this script, I can plug my variable (date) into the vb.net windows form, and it will go off an grab my data. This is a return of the list by date:   [obscured]  /cookcounty/FindDock.asp?NCase=2013-D-08%23%23%23%23&SearchType=1&Database=4&case_no=&PLtype=1&sname=&CDate=09%2F10%2F2013 Then it will need to go into each result to retrieve the above data:   [obscured]  /cookcounty/Finddock.asp?DocketKey=CABDDAAIABA0DR
Category: Web Programming       

c****oy1
 [?]
Sign in to view client's details.
| c****oy1
|    United States
Fixed Price: Less than $500   |  Posted: 42 minutes ago  |  Ends: 14d, 23h  |   0 Proposals
1) Need Oracle order to cash video tutorial to be hosted on my company website. 2) Video should be in SWF format. 3) Trainer should also have good communication and presentation skills. 4) Along with bidding please also share a 2-3 min demo tutorial video to evaluate your skills.
Category: Other IT & Programming       
Skills: oracle Applications, oracle erp       

v****121
 [?]
Sign in to view client's details.
| v****121
|    United States
Fixed Price: Less than $500   |  Posted: 44 minutes ago  |  Ends: 14d, 23h  |   3 Proposals
We are building a new Chinese websites for our company. We need a designer who is good in WP, can read and write Chinese and have good design samples. The tasks are: - Pick a good looking WP template - Put our content together - Build the site with the necessary plugin
Category: Website Design       
Skills: Adobe Photoshop, WordPress       

p****dao
 [?]
Sign in to view client's details.
| p****dao
|    China
Fixed Price: Not Sure   |  Posted: 47 minutes ago  |  Ends: 14d, 23h  |   2 Proposals
We want to develop a simple but effective app for our clients (includes simple web services on wordpress). Read Here's the description   [obscured]  /a/symbiota.com/document/d/1oKd-YJXUMhGMopO-oL8S3jEHP87lAde3vuFXXHlVzCg/edit Please reply specific questions about the project. Skills: * Great coding * Can communicate well via written and spoken English * Easy to work with. * Can work within a team * Can work with our basecamp project management system *** You need to submit a quote. Enough details has been provided***
Category: Mobile Applications       

T****ect
 [?]
Sign in to view client's details.
| T****ect
Hourly Rate: $10 - $15 / hr   |  Duration: 1-2 weeks  |  Posted: 47 minutes ago  |  Ends: 14d, 23h  |   3 Proposals
Test everything on two sites, turn errors completely on, fix each php error. Mostly deprecated functions and stuff. It's joomla 1.5 and virtue mart 1.1.9
Category: Web Programming       
Skills: Joomla!, PHP, PHP5       

s****idh
 [?]
Sign in to view client's details.
| s****idh
|    United States
Fixed Price: Not Sure   |  Posted: 49 minutes ago  |  Ends: 14d, 23h  |   5 Proposals
Hello. We started to build our theme for Themeforest but unfortunately our Developer quit us. We have all pages build in HTML and need to transform in Wordpress Theme. Requirements: Strong Skills HTML, CSS, Responsive design Strong Skills to create professional Wordpress Theme. Please apply only with portfolio of Wordpress Theme.
Category: Web Programming       
Skills: CSS, HTML, PHP, WordPress, Wordpress Theme       

i****tus
 [?]
Sign in to view client's details.
| i****tus
|    United States
Hourly Rate: Not Sure   |  Duration: Not Sure  |  Posted: 52 minutes ago  |  Ends: 89d, 23h  |   4 Proposals
We are in the need of programmers for a videogame that will be released for Android and later for iOS. Requirements: - GameMaker experience. - Git experience (pull, commit, solve conflicts) - moving between screens. - Power up implementation. - Animations (get things moving on screen, art is provided) - Social Media integration. - Ad engines integration. - Store implementation invcluding inApp purchases. Please send your hourly rate and the field you have experience. No need to meet ALL requirements above, work will be split among individuals.
Category: Mobile Applications       

i****app
 [?]
Sign in to view client's details.
| i****app
|    Mexico
Hourly Rate: $10 - $15 / hr   |  Duration: 1-3 months  |  Posted: 52 minutes ago  |  Ends: 14d, 23h  |   0 Proposals
* A genesis framework user / believer * Flexible * Able to work DIRECTLY with developer (not through a "project manager" * Can text and speak English adequately * Will to work with our team for growing needs * Understands WPMS / WPMU setups * Have solid wordpress background * Understands server related issues.. * Can work within team structure * Used or familiar with basecamp (project management software) * Understands the western culture Ready to work ASAP
Category: Other IT & Programming       
Skills: MySQL Administration, HTML, PHP       

T****ect
 [?]
Sign in to view client's details.
| T****ect
Fixed Price: Less than $500   |  Posted: 53 minutes ago  |  Ends: 14d, 23h  |   0 Proposals
1) Need MySQL video tutorial to be hosted on my company website. 2) Video should be in SWF format. 4) Trainer will needs to cover all MySQL Basics 5) Trainer should also have good communication and presentation skills. 6) Along with bidding please also share a 2-3 min demo tutorial video to evaluate your skills.
Category: Other IT & Programming       
Skills: MySQL Administration, MySQL Programming       

v****121
 [?]
Sign in to view client's details.
| v****121
|    United States
Fixed Price: $20 - $50   |  Posted: 53 minutes ago  |  Ends: 2d, 23h  |   1 Proposal
A maven web app need to be revised and configure, it is Spring MVC + hibernate +JSP(NO struts), and I just finish all the functional components, almost the 80% of the whole thing,but need some guy to help me to write some code to configure it right and run it on the Tomcat successfully.
Category: Web Programming       
Skills: JSP, Hibernate, Spring, Bootstrap, mvc       

S****hat
 [?]
Sign in to view client's details.
| S****hat
|    United States
Symbol Key
Payment method not yet verified
Payment verified
Purchased $1-$500
Purchased $500-$5,000
Purchased more than $5,000
You have already submitted a
proposal to this job