Save this Search
     
Sort by:
  • Posted Date
Fixed Price: Less than $500   |  Posted: 1h, 36m ago  |  Ends: 14d, 22h  |   0 Proposals
I have a google spreadsheet with scripts running that I want converted to a commercial version so that I can sell it on the google store. I'm looking for not to expensive method so if experience to make it just in a spreadsheet like I have is OK but I don't want the user to be able to copy the script so I want you to come up with an idea how to make it Or make it a Google app Or make it on a Web interface with login Or make it another spreadsheet but the code will not be in their it will call my sheet to do the action or any it her idea we'll come Here is in short what the script does We can schedule or manual do a prepaid pin phone refill it then logs in to my supplier website and takes the pin and then calls the catier and doed the refill and then scraoes site to verify the refill or does a top up
Category: Other IT & Programming       
Skills: Google App Engine       

e****fer
 [?]
Sign in to view client's details.
| e****fer
|    United States
Fixed Price: $5,000 - $10,000   |  Posted: 1h, 38m ago  |  Ends: 14d, 22h  |   2 Proposals
Dear Developers, I am looking for a website similar to this:   [obscured]   I need complete solution from development, design, hosting. I also want server management solution as well for around 0.5 million members for 2 years. Only experienced professionals contact along with their portfolio. I need complete proposal with costing. Proposal without complete information and costing will be declined immediately. Its going to be outsourced and long-term project.
Category: Other IT & Programming       
Skills: MySQL Administration, HTML, PHP       

w****dnb
 [?]
Sign in to view client's details.
| w****dnb
|    Pakistan
Fixed Price: Not Sure   |  Posted: 1h, 42m ago  |  Ends: 14d, 22h  |   7 Proposals
We need someone to install and deploy "  [obscured]  /" on our server IMMEDIATELY. Please do not use this opportunity as your learning curve. You must already be comfortable with ruby on rails, ruby gems, and heroku.
Category: Other IT & Programming       
Skills: Ruby on Rails       

s****rtc
 [?]
Sign in to view client's details.
| s****rtc
|    United States
Fixed Price: Less than $500   |  Posted: 1h, 43m ago  |  Ends: 14d, 22h  |   0 Proposals
I need the following completed on my site   [obscured]  ,com.au - Note please contact via ELANCE only. I do not respond to direct approaches for work other than to report you as spam. There is a major update for Woo Commerce - i would like someone to do this for me as i am a little nervous about it. The last person didn't actually set it up for me properly so i haven't actually been using it. (I have a subscription to ECWID and i am keen to close it off) I would like to have someone completely setup Woo Commerce for me. Get the shipping and payment options working and tested properley and ALL of my products transferred over (I can give access to my ECWID store and supply the images that are in the store too) The person that did work previous duplicated some items and missed others, the job is so bad i haven't been able to use the store, i believe it may be easier to start from scratch and delete the current listings. Note that the relisting of store items can be quoted as a ...
Category: Other IT & Programming       
Skills: MySQL Administration, HTML, PHP       

n****uds
 [?]
Sign in to view client's details.
| n****uds
|    Australia
Fixed Price: Less than $500   |  Posted: 1h, 57m ago  |  Ends: 14d, 22h  |   1 Proposal
We are looking to have a complete and customized stand alone module designed and built from "scratch." The module must allow users of the eCommerence system (Prestashop v. 1.6.x) the ability to create a "Consignment Seller Accounts" right from their account page. Once, approved by an admin, the user will be allowed add their items for sale using a modified version of the BO's product addition form. The user will first need to agree to a consignment contract which will be fully customizable from the BO. Once, we get the physical items via the mail the BO admin will then "activate" or "deny" specific products. The developer must be available to respond, in a reasonable, timely manner for a period of four weeks to trouble shoot and fix any bugs that may exist. Bugs that relate directly to the project requirements will not incur extra costs and will be covered by the developer. Refer to the attachment. Thanks
Category: Other IT & Programming       
Skills: Prestashop, Module       

u****r17
 [?]
Sign in to view client's details.
| u****r17
|    Pakistan
Fixed Price: Less than $500   |  Posted: 2h, 6m ago  |  Ends: 14d, 21h  |   0 Proposals
photoshop designer:Adobe Photoshop CS6 c&c++programming html writter:excel,powerpoint,word; I am stilling study in my faculty that is computer&information.
Category: Other IT & Programming       
Skills: C, HTML, C++, Adobe Photoshop CS6       

A****h72
 [?]
Sign in to view client's details.
| A****h72
|    Egypt
Fixed Price: $25 - $60   |  Posted: 2h, 16m ago  |  Ends: 14d, 21h  |   15 Proposals
I have a template and I need the contact page created differently. Need this right away!! Will send sample of what I need....
Category: Other IT & Programming       

s****you
 [?]
Sign in to view client's details.
| s****you
|    United States
Fixed Price: Less than $500   |  Posted: 3h, 15m ago  |  Ends: 14d, 20h  |   16 Proposals
We are looking for a independant tester with a long term association. The person should be very good with 1. Requirement Documentation 2. Functional Testing and Reporting 3. Follow up with programmer and resolve issues. If the user is good with phpunit testing , it would be an added advantage.
Category: Testing & QA       
Skills: PHP, Software Testing       

f****sia
 [?]
Sign in to view client's details.
| f****sia
|    Singapore
Fixed Price: Less than $500   |  Posted: 3h, 23m ago  |  Ends: 6d, 20h  |   6 Proposals
Hello to all my friends here at Elance, I need assistance with opening a new Gmail email account for my biz, it would not accept my phone saying I have used it already (or something like that). Can anyone help? some solution? Even open one for me? I don't know where else to turn...and I know you guys are pros. Have a great day, Sam
Category: Other IT & Programming       
Preferred Location: North America

G****t18
 [?]
Sign in to view client's details.
| G****t18
|    United States
Fixed Price: Not Sure   |  Posted: 3h, 31m ago  |  Ends: 14d, 20h  |   1 Proposal
We are a custom t-shirt design company with web based software for the client's creations. We need several short, narrated videos on how to create a shirt. Each video will be 90 seconds or less and the narrator must be a woman that speaks clear English.
Category: Other IT & Programming       

t****guy
 [?]
Sign in to view client's details.
| t****guy
|    United States
Fixed Price: Not Sure   |  Posted: 3h, 52m ago  |  Ends: 14d, 20h  |   2 Proposals
I m looking for samone expert in programation, who can make for me me an application to insert the pages in my site-google( Insert the title of page & insert a link of title ) this applicationn should take tthose two information from my database of shortcut net( i have (4 000 shortcut) that i need to insert in site google the application will can insert minimum 10 pages per minute the site google work with html code
Category: Other IT & Programming       
Skills: HTML, Database       

m****ine
 [?]
Sign in to view client's details.
| m****ine
|    Morocco
Fixed Price: Less than $500   |  Posted: 3h, 58m ago  |  Ends: 14d, 20h  |   0 Proposals
I need to do a lighting system controlled by PIC Microcontroller. This will consist of an array of 9 smd bright LEDs (Osram Oslon SSL leds) controlled by one Ultrasonic Module HC-SR04. An occupancy sensor will start the program if motion is detected in the room, and an LDR (or whichever sensor is best for measuring ambient light) will measure ambient light levels in order to adjust the LEDs levels. When the hand stays at certain position from the ultrasonic sensor, for more than 3 seconds, it will change the light qualities (turning some leds on and off) depending on how far the hand moves from the sensor. I have some of the program written, which sets the ultrasonic module, converts the input into dimensions (cm) and changes the lights according to the distance. I am using a master-slave program and two pics, a a PIC 16F1827 (master, with the sensors) and a PIC16F819 (slave, with the LEDs). I am asking for completing the program, and for the circuit schematic. Ideally some advi...
Category: Other IT & Programming       

J****a33
 [?]
Sign in to view client's details.
| J****a33
|    United Kingdom
Fixed Price: Less than $500   |  Posted: 4h, 52m ago  |  Ends: 14d, 19h  |   8 Proposals
I need a simple app that can do the following: - Login/Register Normal and Facebook, Twitter, Google - Users will be able to leave a tag, location will be saved in the database - Others will receive a notification when they are near a tag - No map interface
Category: Other IT & Programming       
Skills: Android, Android SDK       

c****tea
 [?]
Sign in to view client's details.
| c****tea
|    Romania
Fixed Price: Less than $500   |  Posted: 5h, 49m ago  |  Ends: 2d, 18h  |   4 Proposals
Greetings, I have an Arabic PDF with 232 pages, required to be as a flipping on a CD but must have following features Must have full working Index (there is an Already Index in PDF, remove it or use same) Must Run auto without any error targeting Windows Machines Full Arabic Support with Navigation Menu and Search
Category: Other IT & Programming       
Skills: Adobe Flash, HTML, PDF       

e****ncy
 [?]
Sign in to view client's details.
| e****ncy
|    Saudi Arabia
Fixed Price: Less than $500   |  Posted: 6h, 1m ago  |  Ends: 14d, 17h  |   13 Proposals
We have a web and Mobile site that we need to create direct integration with Paypal, CashU and OneCard... this integration would need to be done using .Net and will be supervised by our product manager who will give greater details into every detail
Category: Other IT & Programming       

a****ilo
 [?]
Sign in to view client's details.
| a****ilo
|    Palestine
Hourly Rate: $15 - $20 / hr   |  Duration: Not Sure  |  Posted: 6h, 15m ago  |  Ends: 14d, 17h  |   3 Proposals
We would like to start using AWS SES to send email from our web server (web server not currently hosted on AWS products). We want to set up AWS with the best practices in order to minimize bounce rates and email send failures. We need an AWS SES expert to help with this setup and teach us how to maintain it. We own the domain thought godaddy so familiar with the godaddy DNS console is a plus. We will provide you with access to our godaddy and aws consoles. We need this setup on the N Virginia zone on aws which we already have been granted production access. Deliverables: Verify domain with DKIM setup through godaddy. Insert appropriate txt records on godaddy Create SPF records Setup ability to receive bounce and complaint notifications Generate SMTP settings for sending email through our current site Verify all email addresses under the domain. (How can we create other email addresses through AWS?) Setup/demonstrate how we can access the logs of sent emails to confirm success o...
Category: Other IT & Programming       
Skills: Email Handling, Amazon Web Services, Email       

A****LLC
 [?]
Sign in to view client's details.
| A****LLC
|    Ireland
Fixed Price: $500 - $1,000   |  Posted: 6h, 19m ago  |  Ends: 14d, 17h  |   6 Proposals
Need to develop a software or script to enable us to send bulk Viber messages (text and photos). Must be able to prevent viber from stopping the registered number after sending a few hundred messages. Must be able to send millions at once. Must be able to: - Upload contacts via XLS, TXT, CSV - Type texts or upload images - Generate report after sending with full status (Delivered / Seen).
Category: Other IT & Programming       
Skills: MySQL Administration, AJAX, HTML, PHP, ASP.NET MVC       

v****oms
 [?]
Sign in to view client's details.
| v****oms
|    United Kingdom
Fixed Price: Less than $500   |  Posted: 10h, 5m ago  |  Ends: 14d, 13h  |   0 Proposals
Hello. I am looking for any experienced modder who has edited or created new game files for the PC Game Call of Duty United Offensive. I am not sure what files you would be working on or the programming involved or I would be more specific on the programming knowledge you need to know. If you have made mods in the past, then you should do fine. As far as I can tell, the game files are in .pk3, .cfg, if you are familiar in working with those, and knowing how to script is also important. I have several game improving ideas that others have actually already made but I am not sure how to separate their mods and use what I like from theirs. For instance, I would like to have a UT2004 headshot voice play when anyone gets a headshot. I know there are a few mods already that have this, which I have, but they do not work with a mod called AWE 2.12. All of these files are again in .pk3, so if you know how to separate that voice mod from one file and add it to another .pk3 or make it it's own .p...
Category: Other IT & Programming       
Skills: Script Writing, .cfg, .dat, .dll, .pk3       

j****mon
 [?]
Sign in to view client's details.
| j****mon
|    United States
Fixed Price: Not Sure   |  Posted: 10h, 17m ago  |  Ends: 6d, 13h  |   3 Proposals
I need a simple system coded in Amibroker which enters trades once per year based on a position score. Please express interest only if you have Amibroker experience and I will provide more details in a word doc. The task needs to be completed by Friday 25th April, although sooner would be better, so please do not respond if you are unavailable to meet the timeframe. Thanks, Andrew.
Category: Other IT & Programming       
Skills: Amibroker       

A****POS
 [?]
Sign in to view client's details.
| A****POS
|    Australia
Fixed Price: $1,000 - $5,000   |  Posted: 10h, 44m ago  |  Ends: 25d, 8h  |   3 Proposals
In general terms, the following requirements has been defined but we would like to receive feedback and discuss about where and how to improve our tool. Strong XBRL and XSLT is required, knowledge in Arelle API is a plus. SOFTWARE REQUIREMENTS ? Web application: software needs to be programmed to work as a cloud application; hired professional will propose technology that best fit to this requirement. ? Model View Controller (MVC) pattern will need to be followed. ? Application will be accessed for several users at a time. ? XSLT stylesheet must be used for transformation. ? Must have support for Chrome, Firefox, IExplorer web browsers. SOFTWARE OBJECTIVES OBJ?01 VIEWER Desc Software will receive an XBRL file or a ZIP file (which have the XBRL file compressed) and will need to render/display it in a Web Browser in a friendly user manner. Stability: High Comments: ? XBRL is an XML file but with an special syntax. ? User will drag and drop the file (XBRL or ZIP) into the web br...
Category: Other IT & Programming       
Skills: .NET Framework, Java, XHTML, XML, XSLT       

s****roz
 [?]
Sign in to view client's details.
| s****roz
|    Chile
Hourly Rate: $30 - $40 / hr   |  Duration: 1-2 weeks  |  Posted: 10h, 44m ago  |  Ends: 25d, 7h  |   6 Proposals
Hello, I am an Android App developer interested in learning more about Android Kernel Development, building the AOSP, flashing custom ROM's, and Android Internals. I'm looking for a tutor to help me get started. Thank you
Category: Other IT & Programming       
Skills: Android       

d****nam
 [?]
Sign in to view client's details.
| d****nam
|    Canada
Fixed Price: $20 - $35   |  Posted: 11h, 44m ago  |  Ends: 14d, 12h  |   6 Proposals
Human DNA is a molecule that encodes the genetic instructions used in the development and functioning of the human body. We don't want to make this a biology course, but let's cut to the chase. Each strand is composed of a sequence of guanine (g), adenine (a), thymine (t), and cytosine (c). Researchers have sequenced the entire human genome and have published the results online in various places. What we want to do is look for patterns in portions of the dna information, So for example, and to make it extremely simple. Here is a very small portion of human chromosome 1: gaattctttcatggttaaaatatcctaagagaagtaacacttctgctcccttcccactcc what we want our program to do is read in this portion, and then tell us how many times a user specified pattern occurs, and where each occurrence is within the portion of chromosome 1 being considered. The project is going to be divided into two phases. The first will deal with getting the struct setup and being able to search for a smaller str...
Category: Other IT & Programming       
Skills: C       

w****ho7
 [?]
Sign in to view client's details.
| w****ho7
|    United States
Fixed Price: Less than $500   |  Posted: 11h, 47m ago  |  Ends: 14d, 12h  |   1 Proposal
1) Need PHP video tutorial to be hosted on my company website. 2) Video should be in SWF format. 3) Trainer will needs to cover all basic PHP topics 4) Trainer should also have good communication and presentation skills. 5) Along with bidding please also share a 2-3 min demo tutorial video to evaluate your skills.
Category: Other IT & Programming       
Skills: PHP       

v****121
 [?]
Sign in to view client's details.
| v****121 *
|    United States
Fixed Price: Less than $500   |  Posted: 11h, 52m ago  |  Ends: 14d, 12h  |   0 Proposals
1) Need Oracle order to cash video tutorial to be hosted on my company website. 2) Video should be in SWF format. 3) Trainer should also have good communication and presentation skills. 4) Along with bidding please also share a 2-3 min demo tutorial video to evaluate your skills.
Category: Other IT & Programming       
Skills: oracle Applications, oracle erp       

v****121
 [?]
Sign in to view client's details.
| v****121
|    United States
Hourly Rate: $10 - $15 / hr   |  Duration: 1-3 months  |  Posted: 12h, 2m ago  |  Ends: 14d, 11h  |   5 Proposals
* A genesis framework user / believer * Flexible * Able to work DIRECTLY with developer (not through a "project manager" * Can text and speak English adequately * Will to work with our team for growing needs * Understands WPMS / WPMU setups * Have solid wordpress background * Understands server related issues.. * Can work within team structure * Used or familiar with basecamp (project management software) * Understands the western culture Ready to work ASAP
Category: Other IT & Programming       
Skills: MySQL Administration, HTML, PHP       

T****ect
 [?]
Sign in to view client's details.
| T****ect
Symbol Key
Payment method not yet verified
Payment verified
Purchased $1-$500
Purchased $500-$5,000
Purchased more than $5,000
You have already submitted a
proposal to this job