Save this Search
     

All JobsFixed Price

 15,132 results  
Sort by:
  • Posted Date
Fixed Price: Less than $500   |  Posted: 58 minutes ago  |  Ends: 6d, 23h  |   2 Proposals
We have a self-service dog wash and grooming shop with a large client database. We send out emails once or twice a month with our special offers. We are looking for someone to create a basic template that we can update each month. We are brand focused, so we need the template to be unique (see attached logo). We use Constant Contact for our email blasts and need to minimize the graphics of each email to minimize the rejections by certain email providers. We are a small business and price is a major consideration. Thanks! Steve
Category: Emails & Newsletters       
Skills: Graphic Design, Adobe Photoshop, Web Design       
Preferred Location: United States

s****ran
 [?]
Sign in to view client's details.
| s****ran
|    United States
Fixed Price: Less than $500   |  Posted: 59 minutes ago  |  Ends: 14d, 23h  |   8 Proposals
***** Ok, EDIT: I need ONE table edited and ONE div edited. I can do this myself in an hour or two so I will not pay a hundred dollars for this job. Let me set a fixed price of $20.00 ******* have an HTML table that needs to be styled responsively. There is one other div that needs some work done to it but not much. This needs to be styled in HTML and then transported over to Wordpress and HTML.
Category: Website Design       
Skills: PHP, CSS3       

F****n07
 [?]
Sign in to view client's details.
| F****n07
|    United States
Fixed Price: Not Sure   |  Posted: 1h, 0m ago  |  Ends: 14d, 22h  |   0 Proposals
We are looking for a public relations superstar! About US We are a new international luxury real estate brokerage based in Beverly Hills, CA. We cater to high end clients both domestically and abroad. Our Need We need a public relations company to assist in carving out a favorable profile for us within this niche sector of real estate using all of the tools at your disposal from events, speaking engagements, social media management, whatever. As you can imagine this job will be an ongoing dynamic for the right company. You must be highly skilled in PR with proper media contacts and can use your creative prowess when it comes to devising our promotional attack. Thanks
Category: Public Relations...       
Skills: Public Relations, Marketing       
Preferred Location: United States

a****503
 [?]
Sign in to view client's details.
| a****503
Fixed Price: Not Sure   |  Posted: 1h, 3m ago  |  Ends: 14d, 22h  |   3 Proposals
Have a single page parallax theme based site which needs to be transferred to a more robust wp theme/site builder. Design also needs a creative designer to be enhanced graphically.
Category: Website Design       
Preferred Location: North America, India/Southern Asia, Central & South America

s****ro1
 [?]
Sign in to view client's details.
| s****ro1
Fixed Price: $300 - $500   |  Posted: 1h, 3m ago  |  Ends: 14d, 22h  |   0 Proposals
JOB DESCRIPTION Art for the game "Urbe Caˇtica" (translating: "Chaotic metropolis"), a game for kids (9 years old), following the graphic directions and visual as specified in the design manual and flowchart. Goal: Analyze a landscape and interfere in order to the environment becomes sustainable. Main Mechanics: The game is set in a city where can be seenthe aspects of urbanization , such as streets and squares , aspects of environmental degradation, areas of deforestation etc. The " Chaotic metropolis " wants to become the " Happy metropolis" and the player receives a mission . When the player clicks on " accept " a letter ( with the appearance of recycled paper ) from the residents of the Chaotic City appears. They are asking for help because they want to be happy in this City. When the player accepts the "mission " , he comes to see a city and a panel with 12 icons . It has an X time to choose the right icons and click...
Category: Other - Design       

t****oro
 [?]
Sign in to view client's details.
| t****oro
|    Brazil
Fixed Price: Less than $500   |  Posted: 1h, 3m ago  |  Ends: 2d, 22h  |   9 Proposals
I am currently building a new website and need a logo designed. The purpose of the site it to offer technical help to new bloggers/business owners in the form of podcasts, tech terminology, etc. In order to be considered for this position, please send me a message with "I want to create the SBG logo" in the subject line.
Category: Logos       
Skills: Adobe Illustrator, Adobe Photoshop       

s****ykc
 [?]
Sign in to view client's details.
| s****ykc
|    United States
Fixed Price: Less than $500   |  Posted: 1h, 6m ago  |  Ends: 14d, 22h  |   0 Proposals
1) Need Ruby on Rail video tutorial to be hosted on my company website. 2) Video should be in SWF format. 3) Trainer will needs to cover all Ruby on Rail Basics 4) Trainer should also have good communication and presentation skills. 5) Along with bidding please also share a 2-3 min demo tutorial video to evaluate your skills.
Category: Web Programming       
Skills: Ruby on Rails, Ruby       

v****121
 [?]
Sign in to view client's details.
| v****121
|    United States
Fixed Price: Less than $500   |  Posted: 1h, 6m ago  |  Ends: 14d, 22h  |   0 Proposals
You can see Facetune to see what effects and fuctions look like, I need you create app with all this effects and functions Job Description: Your responsibilities: - Review business requirements working with other team members - Perform a technical analysis of requirements - Produce a solid, detailed technical design - Write clean, modular, robust code to implement the desired requirements with little or no supervision - Work with the QA and Customer Support teams to triage and fix bugs with rapid turnaround - Contribute ideas for making the application better and easier to use Your qualifications: - A work style that is extremely detail oriented - Strong communication skills - A complete Elance profile - References or an established Elance reputation preferred
Category: Mobile Applications       
Skills: iPhone, Mobile Programming, iPad, iOS       

h****yba
 [?]
Sign in to view client's details.
| h****yba
|    Vietnam
Fixed Price: Less than $500   |  Posted: 1h, 6m ago  |  Ends: 14d, 22h  |   3 Proposals
Hello, We recently created a site in wordpress and just recently we noticed that users are getting a warning using Google Chrome browswer indicating website has malware. Please take a look at   [obscured]  /gift-certificates/ and start to make a payment in Google Chrome to see message.
Category: Web Programming       
Skills: MySQL Administration, Javascript, PHP       

n****sol
 [?]
Sign in to view client's details.
| n****sol
|    United States
Fixed Price: Less than $500   |  Posted: 1h, 7m ago  |  Ends: 14d, 22h  |   0 Proposals
I am looking for a sales person for our retail business voip servies: - Hosted PBX - US Toll Free Number - US Local Number This person will do constant daily marketing on all business related blogs, newsgroup, and linked. This person will sign up clients to use our service via Email, Skyp, and phone.
Category: Lead Generation       
Skills: Internet Marketing, Lead Generation, Sales       

p****dao
 [?]
Sign in to view client's details.
| p****dao
|    China
Fixed Price: $500 - $1,000   |  Posted: 1h, 7m ago  |  Ends: 14d, 22h  |   2 Proposals
I need someone who is very experienced in coding to create a feature rich, nice looking mobile app. It a game where the character has to evade obstacles in a 2-D world. Requirements : -someone who can not only program but can also do the UI design -someone who has at least 300 hours on Odesk -someone who has five star rating -someone who takes pride in their work and makes polished looking products - speaking English well Basic ui designs, design typing objective-c, c programing, iphone, corona. Cocoa Please reply with example of your previous work lecturing any user interface or design example you have done before. If I like your previous work I will reply wand give more details.
Category: Mobile Applications       
Skills: Android, iPhone, iPad       

n****g59
 [?]
Sign in to view client's details.
| n****g59
|    Canada
Fixed Price: Not Sure   |  Posted: 1h, 7m ago  |  Ends: 14d, 22h  |   1 Proposal
What I need is an image of Jesus in a modern day movie theater sitting in a seat and somehow saving the seat nest to him. What I image is Jesus in a row of seats in the foreground with maybe a few rows in the background and him sipping a cola, or tossing a piece of popcorn into his mouth. I think he should be in traditional clothing. I would also need some stylized text that says "Jesus Saves". Let me know what you think.
Category: Art       

S****ion
 [?]
Sign in to view client's details.
| S****ion
|    United States
Fixed Price: Not Sure   |  Posted: 1h, 8m ago  |  Ends: 14d, 22h  |   4 Proposals
5 Pages of work to be done Deadline is tomorrow. Please note is will be about an hour of work per page but can be done in one day. You will have 15 hours to return the work. Original written work required.
Category: Academic Writing       

M****ina
 [?]
Sign in to view client's details.
| M****ina
|    United States
Fixed Price: Less than $500   |  Posted: 1h, 9m ago  |  Ends: 14d, 22h  |   0 Proposals
1) Need HTML video tutorial to be hosted on my company website. 2) Video should be in SWF format. 3) Trainer will needs to cover all HTML Basics 4) Trainer should also have good communication and presentation skills. 5) Along with bidding please also share a 2-3 min demo tutorial video to evaluate your skills.
Category: Web Programming       
Skills: HTML       

v****121
 [?]
Sign in to view client's details.
| v****121
|    United States
Fixed Price: $20 - $35   |  Posted: 1h, 9m ago  |  Ends: 14d, 22h  |   2 Proposals
Human DNA is a molecule that encodes the genetic instructions used in the development and functioning of the human body. We don't want to make this a biology course, but let's cut to the chase. Each strand is composed of a sequence of guanine (g), adenine (a), thymine (t), and cytosine (c). Researchers have sequenced the entire human genome and have published the results online in various places. What we want to do is look for patterns in portions of the dna information, So for example, and to make it extremely simple. Here is a very small portion of human chromosome 1: gaattctttcatggttaaaatatcctaagagaagtaacacttctgctcccttcccactcc what we want our program to do is read in this portion, and then tell us how many times a user specified pattern occurs, and where each occurrence is within the portion of chromosome 1 being considered. The project is going to be divided into two phases. The first will deal with getting the struct setup and being able to search for a smaller str...
Category: Other IT & Programming       
Skills: C       

w****ho7
 [?]
Sign in to view client's details.
| w****ho7
|    United States
Fixed Price: Less than $500   |  Posted: 1h, 9m ago  |  Ends: 14d, 22h  |   1 Proposal
Hello, The Cook County Clerk has a website that displays docket info:   [obscured]  /?section=CASEINFOPage&CASEINFOPage=2400 I would like to be able to search by date, and have the info from each docket number for that date put into a spreadsheet listing the: 1. Docket # 2. Case Type 3. District 4. Party Names 5. Attorney(s) With this script, I can plug my variable (date) into excel, and it will go off an grab my data. This is a return of the list by date:   [obscured]  /cookcounty/FindDock.asp?NCase=2013-D-08%23%23%23%23&SearchType=1&Database=4&case_no=&PLtype=1&sname=&CDate=09%2F10%2F2013 Then it will need to go into each result to retrieve the above data:   [obscured]  /cookcounty/Finddock.asp?DocketKey=CABDDAAIABA0DR I have the code for the macro that works for 2010 down, just need it to work for 365/2013
Category: Web Programming       
Skills: Microsoft Excel, Web Programming, ASP       

c****oy1
 [?]
Sign in to view client's details.
| c****oy1
|    United States
Fixed Price: $500 - $1,000   |  Posted: 1h, 9m ago  |  Ends: 14d, 22h  |   2 Proposals
Our nonprofit just ran a social media campaign (see details of it below) and are now looking for someone to collect all the "high profile" videos and make a video montage with music. To include: - Intro - montage - Call-to-action Reference Sites:   [obscured]  /user/HCC22KILL   [obscured]  /honorcouragecommitmentinc?filter=2   [obscured]  / Details of original campaign: "22 Veterans Commit Suicide Everyday Julie Hersh and the Hersh Foundation along with some partners have pledged up to 0,000 for every 22 pushups from anyone they will donate 0. They must post the videos on Honor Courage Commitment, Inc.'s wall with an introduction of who they are, who they represent, and why they are supporting #22KILL with copy/paste: -- #22KILL "to honor those who serve(d)" -- We encourage group/team/company videos! (deadline is Friday Apr 4th 12pm C) Why is this important? Please read Julie K Hersh's recent article -->   [obscured]  
Category: Videos       
Skills: Video Editing       

0****ire
 [?]
Sign in to view client's details.
| 0****ire
|    United States
Fixed Price: Less than $500   |  Posted: 1h, 11m ago  |  Ends: 14d, 22h  |   6 Proposals
Hi I am looking for some to design a brochure with 4 pages A-4 folded booklet. So, there is 8 pages in total. Please send me your quotation.
Category: Brochures       

p****dao
 [?]
Sign in to view client's details.
| p****dao
|    China
Fixed Price: Less than $500   |  Posted: 1h, 12m ago  |  Ends: 14d, 22h  |   1 Proposal
1) Need PHP video tutorial to be hosted on my company website. 2) Video should be in SWF format. 3) Trainer will needs to cover all basic PHP topics 4) Trainer should also have good communication and presentation skills. 5) Along with bidding please also share a 2-3 min demo tutorial video to evaluate your skills.
Category: Other IT & Programming       
Skills: PHP       

v****121
 [?]
Sign in to view client's details.
| v****121
|    United States
Fixed Price: $100 or less   |  Posted: 1h, 12m ago  |  Ends: 14d, 22h  |   1 Proposal
Need someone to file my company's 503c application to get non profit status. The company is already incorporated. It just needs to an application to get 503c non profit status.
Category: Incorporation       
Skills: Corporate Law, Legal Consulting, Tax Law       

p****ar1
 [?]
Sign in to view client's details.
| p****ar1
|    United States
Fixed Price: Not Sure   |  Posted: 1h, 13m ago  |  Ends: 14d, 22h  |   5 Proposals
I have a row of thumbnail images. If the thumb is active, I give it an active class. All other thumbs have an inactive class. If i then click on another thumb, i want the active class to switch to that thumb and the previous active class to change to inactive. I would also like if a thumb is currently in an inactive state, to have a hover action on it fading its transparency. I can provide you with the testbed code on reply- this should take someone with js expertise a few minutes to fix for me.
Category: Web Programming       
Skills: MySQL Administration, Javascript, PHP       

d****nen
 [?]
Sign in to view client's details.
| d****nen
|    United States
Fixed Price: $37 - $65   |  Posted: 1h, 15m ago  |  Ends: 2d, 22h  |   4 Proposals
Looking to hire multiple writers for a website that provides tips and advice for high school students. Your name will be displayed for the visitor to see. You get to write about topics that you are passionate about. This project is for 40 posts. Each post must be at least 300 words. All content must be 100 % original and unique.
Category: Article Writing       
Skills: Article Writing, Content Writing, Blogs       

t****545
 [?]
Sign in to view client's details.
| t****545
|    United States
Fixed Price: $50 - $175   |  Posted: 1h, 16m ago  |  Ends: 14d, 22h  |   2 Proposals
Hello, The Cook County Clerk has a website that displays docket info:   [obscured]  /?section=CASEINFOPage&CASEINFOPage=2400 I would like a vb.net form to add to my project that will allow me to to search by date, and have the info from each docket number for that date put into a table listing the: 1. Docket # 2. Case Type 3. District 4. Party Names 5. Attorney(s) With this script, I can plug my variable (date) into the vb.net windows form, and it will go off an grab my data. This is a return of the list by date:   [obscured]  /cookcounty/FindDock.asp?NCase=2013-D-08%23%23%23%23&SearchType=1&Database=4&case_no=&PLtype=1&sname=&CDate=09%2F10%2F2013 Then it will need to go into each result to retrieve the above data:   [obscured]  /cookcounty/Finddock.asp?DocketKey=CABDDAAIABA0DR
Category: Web Programming       

c****oy1
 [?]
Sign in to view client's details.
| c****oy1
|    United States
Fixed Price: Less than $500   |  Posted: 1h, 16m ago  |  Ends: 14d, 22h  |   0 Proposals
1) Need Oracle order to cash video tutorial to be hosted on my company website. 2) Video should be in SWF format. 3) Trainer should also have good communication and presentation skills. 4) Along with bidding please also share a 2-3 min demo tutorial video to evaluate your skills.
Category: Other IT & Programming       
Skills: oracle Applications, oracle erp       

v****121
 [?]
Sign in to view client's details.
| v****121
|    United States
Fixed Price: Less than $500   |  Posted: 1h, 19m ago  |  Ends: 14d, 22h  |   5 Proposals
We are building a new Chinese websites for our company. We need a designer who is good in WP, can read and write Chinese and have good design samples. The tasks are: - Pick a good looking WP template - Put our content together - Build the site with the necessary plugin
Category: Website Design       
Skills: Adobe Photoshop, WordPress       

p****dao
 [?]
Sign in to view client's details.
| p****dao
|    China
Symbol Key
Payment method not yet verified
Payment verified
Purchased $1-$500
Purchased $500-$5,000
Purchased more than $5,000
You have already submitted a
proposal to this job