Save this Search
     

All Jobs"C "IT & Programming

 644 results  
Sort by:
  • Posted Date
Fixed Price: $300 - $1,500   |  Posted: 48 minutes ago  |  Ends: 6d, 23h  |   0 Proposals
I need a freelance developer to create a very simple FIX Protocol / Matlab Trading API (should take less than 20 hours if you are familiar with Quickfix /J and Matlab because no business logic is required, I just need to access quickfix methods from matlab, send/receive messages, get streaming quotes and send market orders only). Characteristics: * Can be either programmed in C++, C# or Java using QuickFix or QuickFix/J or QuickFix/n respectively. Java presents a better integration with Matlab, but all of them are possible paths. Matlab functions will be required as well from the Matlab side. * FIX version 4.3 (code is usually anyway the same for other versions, quickfix library takes care of it). * A test FX broker demo account for testing purposes is available, the FIX settings file is also available and also a sample working C#.Net code which almost does everything , connects to a new session, disconnects sessions, place market orders, subscribes to streaming quotes and displ...
Category: Software Application       
Skills: Java, C++, MATLAB, Fix Protocol       

t****der
 [?]
Sign in to view client's details.
| t****der
Fixed Price: Less than $500   |  Posted: 1h, 38m ago  |  Ends: 14d, 22h  |   3 Proposals
Greetings. I am looking for a skilled Parse/iOS mobile app developer to deliver a v1 sports trivia application. If the project goes well, there will be opportunities to continue work on additional, more sophisticated versions of the app. Basic requirements. (note there may be just a little bit of design work necessary to match the color scheme of the parent brand; sportshistory.com). Once a developer is selected, I will forward wireframes that have already been mocked up for the project. Requirements: A. Build for iOS 7 using Parse as the backend. B. Parse components a. Use the PFLoginViewController for Login (including Facebook/Twitter login)   [obscured]  /docs/ios_guide#ui-login/iOS C. Data Questions are sourced from a table called 'Questions' including the following fields: 1. Question 2. Option1, Option2, Option3, Option4 3. CorrectAnswer 4. Points 5. Sport D. Every time a question is answered, a entry into the History table is added with UserID, QuestionID, Correct(true,f...
Category: Mobile Applications       
Skills: iOS 7, Parse       

k****ess
 [?]
Sign in to view client's details.
| k****ess
|    United States
Fixed Price: Less than $500   |  Posted: 2h, 1m ago  |  Ends: 14d, 21h  |   1 Proposal
Hello I have dll file with source code worte with Delphi it's very sample i need to add function in this file to clean client pc from some old versions from my app that conflict with cruuent I'll provide the source code , dll and registery key that need to be removed Thank You.
Category: Software Application       
Skills: C, .NET Framework, Drupal, Delphi, LabWindows/CVI       

d****ind
 [?]
Sign in to view client's details.
| d****ind
|    India
Fixed Price: Less than $500   |  Posted: 2h, 22m ago  |  Ends: 29d, 21h  |   8 Proposals
This is a very small job (but if successful, more jobs will come in the future). ********************************************************************************* I need to update an iOS game. I have all the files ready. For this pilot project - no actual coding is needed. I will send you all the project files, and you will send me back the "ipa" file (since I don't have a mac) That's it! You must have perfect English, be very responsive and a high-quality experienced iOS developer. I can offer this gig no more than $20, so don't bid for more. If this gig is successful, I am planning to develop more games, so this can be a long-term business relationship. Thank you
Category: Mobile Applications       
Skills: iPhone, Xcode, Objective-C, iOS       

b****ale
 [?]
Sign in to view client's details.
| b****ale
|    Israel
Hourly Rate: Not Sure   |  Duration: Not Sure  |  Posted: 5h, 2m ago  |  Ends: 29d, 18h  |   5 Proposals
Description: Need a programmer to work with existing concepts to develop three unique mobile apps. Preference is for a New York City based iOS developer willing to base part of his or her compensation on future sales. "Skin in the game" helps better align our incentives. Requirements: - Meet in Person in New York City - Must have experience coding iOS to create feature rich mobile apps from scratch to iTunes. - Either have created or willing to demonstrate ability to create games, stock market related, and educational apps - Able to deliver quickly upon a mutually agreed upon schedule - Relevant references - Excellent communication in English - Someone who takes pride in polished design in addition to commercial grade coding - Objective C - C Programming - Cocoa - iPhone *** Important: please start your reply with the code phrase "I can meet you in the city" so that I know you have have read and understand the requirements and are not just blindly ...
Category: Mobile Applications       
Skills: iPhone, Cocoa, Objective-C, iPad, iOS       
Preferred Location: United States

N****oup
 [?]
Sign in to view client's details.
| N****oup
|    United States
Fixed Price: Not Sure   |  Posted: 5h, 45m ago  |  Ends: 29d, 18h  |   2 Proposals
We are a budding modelling regulatory and publications company. We publish very informative model helpful books and community blogs We are looking for a good UK based web designer to help expand our current magento website. The ideal candidate will have some experience in working on community based websites and not be only able to advise us but also, suggest inputs to the website (incl. Design) to help us achieve our goals. We are a company that helps advise aspiring and existing models on all things modelling including the best studios and modelling companies and how to avoid being scammed and financially exploited. The website is already up and running and we now wish to take it to the next level. Our initial goal was to sell our books and report (as you may be able to see from the website). However, in this internet age whereby it's all about building traffic, we thought that it would be wiser to offer the content of the books free (which many will better appreciate then bei...
Category: Website Design       
Skills: CSS, HTML, PHP, Magento       
Preferred Location: United Kingdom

R****e22
 [?]
Sign in to view client's details.
| R****e22
|    United Kingdom
Fixed Price: Not Sure   |  Posted: 5h, 58m ago  |  Ends: 14d, 18h  |   4 Proposals
? Skilled use of Java development environment and build various projects ? skilled application of Apache Tomcat, Jboss, Weblogic server ? skilled application of MVC pattern. ? familiar with Struts2, Spring, SpringMVC, HibernatC framework to integrate project development ? familiar with databases Oracle, SQL Server master standard SQL, HQL language ? master MyEclipse, Dreamweaver, aptana, ob10, Toad and other development tools ? Skilled JavaScript, Json, AJAX, JQuery, HTML, EL expression language ? skilled use some third-party plug-ins My97Date, highcharts, CKeditor, iReport, etc. ? familiar with the use and EJB3.0 EJB specification ? familiar with object-oriented OOAD, analysis-oriented interface for software ? able to finish the program needs to design, analyze customer needs. ? understand scoket communications technology and multi-threaded programming, multithreading familiar with common methods
Category: System Administration       
Skills: Java, Apache Struts, Hibernate, Spring, WebLogic       

K****_GA
 [?]
Sign in to view client's details.
| K****_GA
|    China
Fixed Price: Less than $500   |  Posted: 6h, 25m ago  |  Ends: 14d, 17h  |   0 Proposals
photoshop designer:Adobe Photoshop CS6 c&c++programming html writter:excel,powerpoint,word; I am stilling study in my faculty that is computer&information.
Category: Other IT & Programming       
Skills: C, HTML, C++, Adobe Photoshop CS6       

A****h72
 [?]
Sign in to view client's details.
| A****h72
|    Egypt
Fixed Price: Less than $500   |  Posted: 6h, 43m ago  |  Ends: 14d, 17h  |   1 Proposal
Overview: This tool monitors your keyboard activity and if you go a set period of time without typing it will fade your screen and/or play a sound.. To begin, a user selects an amount of seconds, then, hits start. If they fail to type using any keys on the keyboard for the amount of time selected, the program will cause the screen to begin dimming. Once the user enters another key, the screen will automatically convert back to a regular (non-dimmed) screen, and the countdown will begin again. This will continue until the user closes the program. The purpose of the tool is designed for writers. Instead of stalling and not typing anything on the screen, the dimming effect will alert them to continue writing. The goal should be to constantly keep using the keyboard, that way the screen never dims. A constant dimming reminder alerts the user to keep pushing forward with their composition. Features: - No Internet access required after installation User Interface: It should have an inpu...
Category: Software Application       
Skills: Cocoa, Mac OSX, Objective-C       

n****e24
 [?]
Sign in to view client's details.
| n****e24
Fixed Price: Less than $500   |  Posted: 8h, 17m ago  |  Ends: 14d, 15h  |   0 Proposals
I need to do a lighting system controlled by PIC Microcontroller. This will consist of an array of 9 smd bright LEDs (Osram Oslon SSL leds) controlled by one Ultrasonic Module HC-SR04. An occupancy sensor will start the program if motion is detected in the room, and an LDR (or whichever sensor is best for measuring ambient light) will measure ambient light levels in order to adjust the LEDs levels. When the hand stays at certain position from the ultrasonic sensor, for more than 3 seconds, it will change the light qualities (turning some leds on and off) depending on how far the hand moves from the sensor. I have some of the program written, which sets the ultrasonic module, converts the input into dimensions (cm) and changes the lights according to the distance. I am using a master-slave program and two pics, a a PIC 16F1827 (master, with the sensors) and a PIC16F819 (slave, with the LEDs). I am asking for completing the program, and for the circuit schematic. Ideally some advi...
Category: Other IT & Programming       

J****a33
 [?]
Sign in to view client's details.
| J****a33
|    United Kingdom
Fixed Price: Not Sure   |  Posted: 8h, 48m ago  |  Ends: 29d, 15h  |   10 Proposals
Want a Dynamic/E-commerce website for matrimonial services; designed totally matching the latest trending technology. Ease of access and mobile friendly. Should be a certified web developer and should submit photocopies of your certificates. Should sign in a general agreement for not sharing the website design/codes or copying as said 'illegal'. Domain name and a private space for hosting will be provided. Since there are many sites already existing, there is no layout plan prepared. Your challenge is to make the website even better than the existing websites with good 'sort' features. The work will be awarded for the least quoted (L1). There are many persons out in India who can build at a cheaper rate, so think over your quotation meticulously and don't just add in the zero's. You may have to build more websites in the future if you impress me with your talent. All The Best.. !! Wishes and Regards Bhushan Nayak Ref: jeevansathi.com; shaadi.com or just hit "matrimony". ...
Category: Website Design       
Skills: AJAX, CSS, XHTML, Web Design, cPanel       

b****dis
 [?]
Sign in to view client's details.
| b****dis
|    India
Fixed Price: Not Sure   |  Posted: 9h, 59m ago  |  Ends: 14d, 14h  |   4 Proposals
There is an Open Source Poker software by Cubeia.org It is mainly implemented in JAVA. The client is HTML5 / JavaScript using WebSockets. We would like to edit and add more features to the software. PLEASE CHECK OUT THE SOFTWARE BEFORE BIDDING AT:   [obscured]   You can check the sourcecode of the program here:   [obscured]  /lazaridis_com/cubeia-poker/get/c9edf4aaa3b4.zip The following features needed to programmed: - Change the style and graphics of the table - Implementation of REST API with front end - Complete registration of players using the API If you know you can make one of these features please give me an offer with price and the name of the feature you can make. we have already explored the options and aware of the immediate job requirement. We will guide the person in the right direction to get the task done. The person should have experience knowledge in JAVA, Apache tomcat, MySQL , REST API , CURL
Category: Software Application       
Skills: MySQL Administration, Java, PHP, Apache Tomcat, cURL       

h****duh
 [?]
Sign in to view client's details.
| h****duh
|    Australia
Hourly Rate: $15 - $20 / hr   |  Duration: Not Sure  |  Posted: 10h, 18m ago  |  Ends: 6d, 13h  |   21 Proposals
I'm in need of an experienced iOS developer to develop an app from a completed wireframe I currently have. I will provide materials such as- A spec document (with everything I'm aware of that is needed), and an interactive prototype complete with content. This application must use Native objective-c language and built in Xcode. location based API will be needed, Social media (Twitter/Facebook) Api's, Push notifications and Chat functions. I have a wireframe done and would like to prepare it for the App Store. This will be an on-gong project (maybe). More so in terms of updating and following Apple App store guidelines and updates.
Category: Mobile Applications       

g****izz
 [?]
Sign in to view client's details.
| g****izz
|    United States
Fixed Price: Not Sure   |  Posted: 10h, 30m ago  |  Ends: 59d, 13h  |   6 Proposals
Hi, We need a freelancer to do this project: The use can upload a book document and brief about it on the portal, the admin will review it and if it is accepted then he will generate the book by using wizard to make the book as iOS (iPhone + iPad) + Andoid Native App. The wizard has some option like: 1. Input PDF files: - Customer upload Files form his PC. - Customer can choose the page resolution in output application. - Customer can test the output resolution. - Customer can define book Info. "Name, Author, and Logo ?. etc." - Customer define table of content. "List each chapter and page" - Define book-reading direction. "Right to left" or "Left to Right" 2. Output application Reedy templates: - Chosen from 5 to 10 ready skin templates of application layout. - Upload application background. - Customize thumbnails bane. - Add new skin templates in the features. 3. Output application features: - Use can search inside book. - Use can Highligh...
Category: Mobile Applications       
Skills: Android, iPhone, .NET Framework, Java, Objective-C       

k****oqi
 [?]
Sign in to view client's details.
| k****oqi
|    Saudi Arabia
Fixed Price: Less than $500   |  Posted: 10h, 38m ago  |  Ends: 14d, 13h  |   20 Proposals
AIM: to install and setup a new ecommerce Wordpress plugin to facilitate orders and payments via Paypal and Direct Deposit, for roughly 4 - 10 products, on the wordpress website:   [obscured]  / i) there is currently an ecommerce plugin installed, called 'thecartpress'. But we have many issues with this plugin. We are looking to replace this cart/checkout system with a new one. You can view the current plugin on this page:   [obscured]  /online-store/ ii) we would like the new ecommerce plugin to be simpler and easier to use for the novice internet buyer. Many customers of the site do not purchase online regularly. Technical Requirements: a) must include shopping cart functionality b) each product should have an add to cart button c) default option in checkout for guest/anonymous user (meaning the customer is not asked to log in as a register user) d) setup to process payments with Paypal e) payment option to pay via Bank Deposit f) it should be easy for us for...
Category: Website Design       
Skills: CSS, HTML, PHP, WordPress, Ecommerce       

s****amp
 [?]
Sign in to view client's details.
| s****amp
|    Australia
Fixed Price: $500 - $1,000   |  Posted: 10h, 42m ago  |  Ends: 14d, 13h  |   8 Proposals
Hi Guys I would like to develop an online portal for B2C model , reference sites are   [obscured]   /   [obscured]   . those people who have expertise on business portal development . Please revert to me at following email address for further discussion.. or cordinate with me at skype mmittal.er Regards Mukesh Mittal
Category: Website Design       
Skills: PHP, CakePHP, .NET for Web       

m****006
 [?]
Sign in to view client's details.
| m****006
|    Singapore
Fixed Price: $35 - $45   |  Posted: 12h, 24m ago  |  Ends: 14d, 11h  |   6 Proposals
Urgent, I am looking for a good Wordpress developer to create/customize a form (Post type) to create a classified ads section on my website. Everything need to be "responsive" 1) Publishing Once the form is filled through the frontend panel: a) Admin (me) will publish the pending post and/or b) Post will be automatically published based on user privilege 2) User privilege All users can submit a post after registering for free. The form (Post type) works with Paid Memberships Pro which has an "extension" which will allow the submitted post to be: a) Accessible and "pending" for the members/users who wants to use it free of charge. b) Accessible and automatically publishable for and by members/users who "paid to post." the - paid to post - function which can be found here   [obscured]  /strangerstudios/2232405 will be a bit tweaked. 3) Editing a) Paid to post users pay only once and can edit their post as much as they want ...
Category: Blog Programming       
Skills: CSS, PHP, WordPress       
Preferred Location: North America, Eastern Europe, India/Southern Asia, Eastern Asia

g****hel
 [?]
Sign in to view client's details.
| g****hel
|    United States
Fixed Price: Less than $500   |  Posted: 13h, 19m ago  |  Ends: 14d, 10h  |   4 Proposals
I currently have a prototype application that I have written in Objective C in XCode that allows a user to log into the application via Facebook. The application connects to a back-end hosted on Parse.com and downloads a list of recent "check-in" activity from Facebook Friends that are also using the prototype application. The user can "check-into" places. When the user decides to "check-in," the application then displays a list of nearby places based on the Facebook Places API and the user's current location. The application saves the "check in" to the Parse.com back-end and shows the "check-in" in the recent activity listing. I would like to implement background location with significant location changes and region monitoring, but I am having trouble doing this on my own and am looking for assistance. As a first project, I would like to modify the above application to do the following. The user can "check-into" places....
Category: Mobile Applications       

E****hic
 [?]
Sign in to view client's details.
| E****hic
|    United States
Hourly Rate: $15 - $20 / hr   |  Duration: Not Sure  |  Posted: 14h, 51m ago  |  Ends: 1d, 9h  |   12 Proposals
I have an existing user facing site that I need an iOS app for. It's a photo sharing app. I can share the details with the person I select. You will emulate the HTML5 PHP site as much as possible, except for the design, which I hope you can do a better job with. If it goes well, you get the Android app job next.
Category: Mobile Applications       
Skills: Android, iPhone, Objective-C, iPad, Bootstrap       

E****H73
 [?]
Sign in to view client's details.
| E****H73 *
|    United States
Fixed Price: Not Sure   |  Posted: 15h, 23m ago  |  Ends: 14d, 8h  |   5 Proposals
Hi, I need some help developing a Joomla or a similar CMS based website for one of my side projects. The website will be an interactive website very similar to schooloftutors.com in terms of design and features. Some of the basic features will be 1. It should be a SEO friendly responsive web design and hence use the latest Joomla 3.x version w/ bootstrap 2.Compatible with Firefox, Chrome, Safari, Opera, and Internet Explorer versions 8 and newer. 3.Linkedin and Facebook Login integration w/ Email option 4.Basic Search and Advance Searched & Display functions. Results display should follow admin defined algorithm (assigning of points via a spectrum of factors & ranking tutors accordingly). 5.Main section includes: a. Dashboard Section b. Profile section - Verification of social presence (facebook, twitter, linkedin account), Managing profile (writing about experience, commitment, editing previously input values, answering frequently asked questions), ...
Category: Website Design       
Skills: Drupal, HTML, Joomla!, PHP, MySQL Programming       

s****jsy
 [?]
Sign in to view client's details.
| s****jsy
|    India
Fixed Price: $500 - $1,000   |  Posted: 16h, 1m ago  |  Ends: 14d, 7h  |   6 Proposals
I need someone who is very experienced in coding to create a feature rich, nice looking mobile app. It a game where the character has to evade obstacles in a 2-D world. Requirements : -someone who can not only program but can also do the UI design -someone who has at least 300 hours on Odesk -someone who has five star rating -someone who takes pride in their work and makes polished looking products - speaking English well Basic ui designs, design typing objective-c, c programing, iphone, corona. Cocoa Please reply with example of your previous work lecturing any user interface or design example you have done before. If I like your previous work I will reply wand give more details.
Category: Mobile Applications       
Skills: Android, iPhone, iPad       

n****g59
 [?]
Sign in to view client's details.
| n****g59
|    Canada
Fixed Price: $20 - $35   |  Posted: 16h, 3m ago  |  Ends: 14d, 7h  |   6 Proposals
Human DNA is a molecule that encodes the genetic instructions used in the development and functioning of the human body. We don't want to make this a biology course, but let's cut to the chase. Each strand is composed of a sequence of guanine (g), adenine (a), thymine (t), and cytosine (c). Researchers have sequenced the entire human genome and have published the results online in various places. What we want to do is look for patterns in portions of the dna information, So for example, and to make it extremely simple. Here is a very small portion of human chromosome 1: gaattctttcatggttaaaatatcctaagagaagtaacacttctgctcccttcccactcc what we want our program to do is read in this portion, and then tell us how many times a user specified pattern occurs, and where each occurrence is within the portion of chromosome 1 being considered. The project is going to be divided into two phases. The first will deal with getting the struct setup and being able to search for a smaller str...
Category: Other IT & Programming       
Skills: C       

w****ho7
 [?]
Sign in to view client's details.
| w****ho7
|    United States
Hourly Rate: $20 - $30 / hr   |  Duration: 1-3 months  |  Posted: 16h, 9m ago  |  Ends: 2d, 7h  |   1 Proposal
This job is to provide ongoing tutoring services for DirectX 11 and C++. Total hours will vary but the first 2 weeks will be daily tutoring with 1-2 hours each day including weekends if possible. The tutoring will be for someone with software development experience but no experience with DirectX and a little experience with C++. Hours will be between 7PM and 11PM Central Standard Time. Duration will be 1-3 months. Topics covered range from basic DirectX 11 project setup using Visual Studio 2013 to more advanced concepts such as networking, database integration and streaming animated interactive DirectX output. Sessions will be done via Skype or any other available web conference system.
Category: Software Application       
Preferred Location: North America

c****ron
 [?]
Sign in to view client's details.
| c****ron
|    United States
Fixed Price: Not Sure   |  Posted: 16h, 23m ago  |  Ends: 14d, 7h  |   1 Proposal
Gentleman (..and ladies of course) I want to make a simple page with a form, submit button, and a total at the top such as this:   [obscured]  /1040/FederalTaxes/Ask/Income/GettingStarted I would like to be able to choose what the question is, what type of response (entry form, drop down menu, check box), and the value of that completed response The total at the top keeps track of added values. Upon submit all values are logged along with time/ip data etc. I would be emailed a sheet of the data. --- I dont know how much more this complicates things, but Instead of a menu on the side, I would like the ability to make subsequent questions appear, for instance, if someone answers yes on 34, 34 a, b, c, d should unlock before it continues on to 35. I want to get this done as simple/quickly/cheaply as possible. Thanks for all of you who want to help!
Category: Other IT & Programming       

I****ver
 [?]
Sign in to view client's details.
| I****ver
|    United States
Fixed Price: $150 - $250   |  Posted: 18h, 56m ago  |  Ends: 14d, 5h  |   4 Proposals
Canonical fixation Html sitemap addition Xml sitemap addition Robots.txt addition Html Errors fixation(limited to 50 errors) .fix key word stuffing Change/add Meta keywords addition/optimization in terms of SEO / change shorten to 160 words Meta description addition/optimization in terms of SEO Title addition/optimization in terms of SEO H1 addition/optimization in terms of SEO Images alt tagging x 10 home page add a few cloud key words w3c errors x 30 Microformats addition to website Dublin core addition to website Tag no follow to external links from website Broken links removal see attachment . re direct high rank broken links . css mobile . mobile redirection . increase mobile loading time
Category: Other IT & Programming       
Skills: HTML, PHP       

g****awz
 [?]
Sign in to view client's details.
| g****awz
|    Australia
Symbol Key
Payment method not yet verified
Payment verified
Purchased $1-$500
Purchased $500-$5,000
Purchased more than $5,000
You have already submitted a
proposal to this job