Save this Search
     

All Jobspattern making

 52 results  
Sort by:
  • Posted Date
Fixed Price: $20 - $35   |  Posted: 11h, 47m ago  |  Ends: 14d, 12h  |   6 Proposals
Human DNA is a molecule that encodes the genetic instructions used in the development and functioning of the human body. We don't want to make this a biology course, but let's cut to the chase. Each strand is composed of a sequence of guanine (g), adenine (a), thymine (t), and cytosine (c). Researchers have sequenced the entire human genome and have published the results online in various places. What we want to do is look for patterns in portions of the dna information, So for example, and to make it extremely simple. Here is a very small portion of human chromosome 1: gaattctttcatggttaaaatatcctaagagaagtaacacttctgctcccttcccactcc what we want our program to do is read in this portion, and then tell us how many times a user specified pattern occurs, and where each occurrence is within the portion of chromosome 1 being considered. The project is going to be divided into two phases. The first will deal with getting the struct setup and being able to search for a smaller str...
Category: Other IT & Programming       
Skills: C       

w****ho7
 [?]
Sign in to view client's details.
| w****ho7
|    United States
Fixed Price: Less than $500   |  Posted: 20h, 51m ago  |  Ends: 6d, 3h  |   20 Proposals
Lelle Moda (meaning Fashion for Dolls) is a one woman online store on Etsy.com specializing in knitting patterns for doll clothing. The logo design can be a font (preferably) or a font with a pic. The logo should be readable as a part of my patterns'c cover page when scaled down to an Etsy.com thumbnail format. Please no corporate and stock logo samples, only your original artwork. Will appreciate your first impulse sample for logo to help me with selection process. Job description: I prefer a clean look but with a twist that makes it memorable. That twist can be cheeky or funny, but not overly cute. Think of a girl in her teens. Theme of the logo - doll fashion (without specific reference to knitting). Prefer text based logo. Will provide links to samples if needed. A small follow up project might follow ( master cover page for my patterns with the incorporated logo) I am an older woman, new to this site and might stumble around, sorry for that. Logo type: Other o...
Category: Logos       
Preferred Location: North America, Western Europe, Eastern Europe, Australia/Oceania

i****301
 [?]
Sign in to view client's details.
| i****301
|    United States
Fixed Price: About $50   |  Posted: 23h, 18m ago  |  Ends: 14d, 0h  |   4 Proposals
We are looking for a handful of graphic designers for a fun little project. We are going to start to create a handful of "themes" for an idea board (like a powerpoint presentation online) solution we are building. The system works very easily - a user can drag and drop pictures onto a board as well as add text. The boards also havea "title block" with their company and project information. They can do basic things with the pictures, such as resize, crop, move and rotate. We limit other things as these users are NOT graphic designers and our goal is to give them a very quick and simple way to create visually stunning presentations. The goal of themes is to provide users with a design already created they can use for their presentation, this way they can simply drag and drop pictures and place them where it makes sense based on the theme (i.e. if the theme has an opaque strip on the left, the users should drop pictures on that strip) as well as add text where ...
Category: Graphic Design       
Skills: Graphic Design, Web Design, theme design       

n****inc
 [?]
Sign in to view client's details.
| n****inc
Fixed Price: $50 - $100   |  Posted: Apr 17, 2014  |  Ends: 12d, 2h  |   34 Proposals
Lelle Moda (meaning Fashion for Dolls) is a one woman online store specializing in knitting patterns for doll clothing. The logo design can be a font (preferably) or a font with a pic. The logo should be scalable and readable in a thumbnail format. The logo will be used as a banner on a standalone website, Etsy store, product thumbnails and printouts. Job description: I prefer a clean look but with a twist that makes it memorable. That twist can be cheeky or funny, but not overly cute. Think of a girl in her teens. Will provide links to samples. Logo type: Other or Not Sure
Category: Logos       

i****301
 [?]
Sign in to view client's details.
| i****301
|    United States
Fixed Price: Not Sure   |  Posted: Apr 17, 2014  |  Ends: 3d, 19h  |   23 Proposals
Hi, We sell beautiful handmade rugs online at   [obscured]   (only visible in India via   [obscured]  ). Interior architects love our rugs as they are 100% customizable in terms of colours, patterns and size. We'd now like to make our rugs more known to interior architects in the USA. Therefore, we are looking for someone to: 1) First do research and make a list of 500 American interior architect firms in MS Excel (firm name, contact person, e-mail, website, address) 2) Send a personal e-mail (we'll provide the template) to each firm 3) Handle replies from these firms and build a relationship with them Goal is to interest them in our product. The e-mail includes an offer for a free colour chart. The number of firms that wants to receive a colour chart is a good measure of your success! You'll work from an official @feltballrug.com e-mail address. We are looking for someone to help us for the long term (there are a lot more firms than 500 and also more countries). This ...
Category: Lead Generation       
Skills: Email Marketing, Lead Generation, Sales       

w****lle
 [?]
Sign in to view client's details.
| w****lle
|    Netherlands
Hourly Rate: Not Sure   |  Duration: 7-9 months  |  Posted: Apr 17, 2014  |  Ends: 11d, 19h  |   5 Proposals
You're looking for a consistent and long-term application ui design job, this is it. You will start at 4 hours/day, 5 days/week. This number will increase for the right person who always wanted to have a steady design position. You can bill for these hours, even during slow times when you don't have anything to do. For each part of each project you will be given clear, detailed instructions so you'll know what is expected of you and to prevent misunderstandings. Your variety of assignments will include the following: - develop client and project briefs - assist with information architecture - design responsive consumer-facing web applications (not sites) - design responsive mobile applications - include sophisticated transitions and effects in your design work (if you can design it, we can make it real) - icons, logos, branding and printed media work on occasion This is a position for someone who likes solving design challenges and creating things that make sense and make people s...
Category: Website Design       
Preferred Location: North America, Western Europe, Eastern Europe, Eastern Asia, Middle East & Central Asia, Central & South America, Australia/Oceania

u****lio
 [?]
Sign in to view client's details.
| u****lio
|    United States
Hourly Rate: Not Sure   |  Duration: 7-9 months  |  Posted: Apr 17, 2014  |  Ends: 11d, 19h  |   1 Proposal
You're looking for a consistent and long-term application ui design job, this is it. You will start at 4 hours/day, 5 days/week. This number will increase for the right person who always wanted to have a steady design position. You can bill for these hours, even during slow times when you don't have anything to do. For each part of each project you will be given clear, detailed instructions so you'll know what is expected of you and to prevent misunderstandings. Your variety of assignments will include the following: - develop client and project briefs - assist with information architecture - design responsive consumer-facing web applications (not sites) - design responsive mobile applications - include sophisticated transitions and effects in your design work (if you can design it, we can make it real) - icons, logos, branding and printed media work on occasion This is a position for someone who likes solving design challenges and creating things that make sense and make people s...
Category: User Experience Design       
Preferred Location: North America, Western Europe, Eastern Europe, Eastern Asia, Middle East & Central Asia, Central & South America, Australia/Oceania

u****lio
 [?]
Sign in to view client's details.
| u****lio
|    United States
Hourly Rate: Not Sure   |  Duration: 7-9 months  |  Posted: Apr 17, 2014  |  Ends: 11d, 19h  |   11 Proposals
You're looking for a consistent and long-term application ui design job, this is it. You will start at 4 hours/day, 5 days/week. This number will increase for the right person who always wanted to have a steady design position. You can bill for these hours, even during slow times when you don't have anything to do. For each part of each project you will be given clear, detailed instructions so you'll know what is expected of you and to prevent misunderstandings. Your variety of assignments will include the following: - develop client and project briefs - assist with information architecture - design responsive consumer-facing web applications (not sites) - design responsive mobile applications - include sophisticated transitions and effects in your design work (if you can design it, we can make it real) - icons, logos, branding and printed media work on occasion This is a position for someone who likes solving design challenges and creating things that make sense and make people s...
Category: Mobile Design       
Preferred Location: North America, Western Europe, Eastern Europe, Eastern Asia, Middle East & Central Asia, Central & South America, Australia/Oceania

u****lio
 [?]
Sign in to view client's details.
| u****lio
|    United States
Hourly Rate: Not Sure   |  Duration: 7-9 months  |  Posted: Apr 17, 2014  |  Ends: 11d, 19h  |   2 Proposals
You're looking for a consistent and long-term application ui design job, this is it. You will start at 4 hours/day, 5 days/week. This number will increase for the right person who always wanted to have a steady design position. You can bill for these hours, even during slow times when you don't have anything to do. For each part of each project you will be given clear, detailed instructions so you'll know what is expected of you and to prevent misunderstandings. Your variety of assignments will include the following: - develop client and project briefs - assist with information architecture - design responsive consumer-facing web applications (not sites) - design responsive mobile applications - include sophisticated transitions and effects in your design work (if you can design it, we can make it real) - icons, logos, branding and printed media work on occasion This is a position for someone who likes solving design challenges and creating things that make sense and make people s...
Category: Graphic Design       
Preferred Location: North America, Western Europe, Eastern Europe, Eastern Asia, Middle East & Central Asia, Central & South America, Australia/Oceania

u****lio
 [?]
Sign in to view client's details.
| u****lio
|    United States
Fixed Price: $200 - $300   |  Posted: Apr 16, 2014  |  Ends: 10d, 17h  |   12 Proposals
I am representing a dragon boat team based in Singapore called the Gaelic Dragons. As such, our current logo has may design elements borrowed from Gaelic history/mythology, but with one problem. The design does not translate well into the variety of modern media available today. Basically, it's not versatile. We need something that maintains the traditional elements of our current logo but translates much better onto our uniforms, letterhead, business cards, etc. and can by recognized in black & white, color, and digital formats. If you are interested please read more about the history of our logo below, examine the sample images provided and make a short proposal. Looking forward to working with you! The Gaelic Dragons Logo - A sign of Unity and Continuity The significance of Gaelic: The Gaelic language and culture originated in Gaelic Ireland and southwest Scotland. Irish is a Celtic language, as is Scottish Gaelic, Manx Gaelic (Manx), Welsh, Breton and Cornish. David Bea...
Category: Logos       

s****ken
 [?]
Sign in to view client's details.
| s****ken
|    United States
Hourly Rate: $15 - $40 / hr   |  Duration: 7-9 months  |  Posted: Apr 15, 2014  |  Ends: 25d, 0h  |   18 Proposals
Experienced JavaScript Developers Wanted For Product Expansion Electricity Labs is looking for experienced JavaScript developers to assist in building on new feature sets and expanding the capabilities of our software development product, Bolt. You will have the following responsibilities while working on our projects: - Work with development team to build reusable UI components - Write clean, maintainable code following best practices (unit testing, source control, continuous integration, automation, design patterns, etc.) - Debug code and troubleshoot problems - Collaborate with other developers, testers, and system engineers to ensure quality product enhancements - Follow Agile Scrum methodology You will also be required to use our software development platform in order to do the various tasks assigned to you from our in house development team. What are we looking for in a candidate? Here is a list of desired skills and experience that will ensure you are successful at th...
Category: Software Application       

e****abs
 [?]
Sign in to view client's details.
| e****abs
|    United States
Fixed Price: $1,000 - $1,000,000   |  Posted: Apr 15, 2014  |  Ends: 9d, 20h  |   58 Proposals
We are a communications company registered in a high emerging economy market and Innovation is key to what we do. We had an online social media website, which was done by Infosys sometime in 2003 and want to start from the scratch a new social media website. We aim to be one of the largest worldwide social network for meeting new people. We want to showcase great social network fundamentals that primarily focus on giving users the best tools to grab attention of others as well as expand their social circles. We intend to carve a big niche within the continent within 5 years. We seek a web and mobile designer & developer that shall play a key role in shaping our product as we aim to provide two things: giving people a dating site that's easy to use, and writing that site with code that's easy to read. This is a great opportunity to work on an exciting project with an exceptionally motivated team of entrepreneurs who have had success in other endeavours, and we are looking for som...
Category: Web Programming       
Skills: CSS, HTML, Javascript, PHP       

o****bra
 [?]
Sign in to view client's details.
| o****bra
|    United States
Fixed Price: Less than $500   |  Posted: Apr 15, 2014  |  Ends: 24d, 16h  |   5 Proposals
ZOHO CRM ? Integrate with Google App, share contact and email, calendars, etc. ? Create web form, capture lead directly from website; Integrate with 3DCART, share contact, purchase follow up. ? Customize function, and create workflow rule; ? Sales force automation ? Marketing automation. . Microsoft office Plug in. MYOB Accounting: Customers & Vendors - Full Contact Management including merging and synchronization Items - are fully integrated with ZOHO CRM or 3D Cart with full support for Inventory, Non-Inventory, Assembly and Service Items. Invoices - can be automatically created in your MYOB file from the orders in ZOHO CRM or 3D Cart. Notes: We intend to moving MYOB Accountin right V 19 to MYOB Accounting Right Live Plus in 2 months, hope it will be easy for integration. The data need to get access to with 3dCart integration: 1: Orders placed, including total amount spent, discounts applied, coupon codes, and more. 2. Items purchased, including quantity...
Category: Web Programming       
Skills: CRM, Ecommerce, API, Google App       

g****wu2
 [?]
Sign in to view client's details.
| g****wu2
|    Australia
Fixed Price: $500 - $1,500   |  Posted: Apr 14, 2014  |  Ends: 1d, 1h  |   1 Proposal
We are seeking someone who is familiar with the Amazon seller marketplace, EBay seller marketplace and Microsoft Excel. Also having knowledge of TV Shows, Movies, Video Games and other entertainment products would be helpful. You must be as consistent as possible and able to work in a timely manner. Task: You will be given a .xlsx excel file with a list of products that are listed on Amazon with blank columns that have the specific details. The top of the file shows various examples of how the different fields should be filled out with acceptable answers for each cell to use as reference. Most of the information can be found within the Amazon listing but some might require best judgement if the listing on Amazon does not have the information. Main File (needs to be filled out)- Product Attributes.xlsx- Attached is a sample file of how the sheet will look and blanks that need to be filled out. You will be given limited access to view these products to fill out the blank cells. There a...
Category: Other - Sales & Marketing       

f****ker
 [?]
Sign in to view client's details.
| f****ker
|    United States
Fixed Price: Less than $500   |  Posted: Apr 14, 2014  |  Ends: 8d, 21h  |   17 Proposals
Hi freelancers I have attached a previous logo that was developed for me, but needs improving and more professional. Basically i want to keep the hand drawn aspects of the logo, but would like "Wye Valley Pet Bakery" to be in 1 straight line, not in a circle pattern as shown in the attachment. I would like to keep the cat and dog, hopefully in similar fashion, both looking towards to logo, maybe do another 1 without, just so i can see what looks best. I would like the logo name to be in a grass green, not to light though and not to dark. Blow that i would like a dog bone with a bite mark in it and the word "Pet Bakery" The bone wants to be a whitey/light brown color and Pet Bakery can be in what ever color looks best. Finally i would like there to be some crumbs on the floor of the logo, right underneath the bite mark on the bone. Maybe add some natural setting in the background of the logo, i.e. countryside rolling hills, with some tiny butterflys and a sun in t...
Category: Logos       

a****ons
 [?]
Sign in to view client's details.
| a****ons
|    United Kingdom
Hourly Rate: Not Sure   |  Duration: Not Sure  |  Posted: Apr 14, 2014  |  Ends: 8d, 20h  |   1 Proposal
We are a contact center based on Spain with clients around the world. We focus our activity in e-commerce business. We are looking for commercial agents to help us with our services. ESSENTIAL HIGH LEVEL OF PORTUGUESE Functions: - Phone sales of different products or services. - Business Track, negotiation and closing. - Report daily tracking service. Requirements: ? Education: Engineering Business Administration and Business Management, Marketing or other studies to commercial sale. ? Essential: - Minimum of 1-3 years in sales. - Experience in customer service. - Advanced user of internet and office. - Good spelling , respecting punctuation , accents and tildes. Excellent grammar. - Proactive , ability to thrive under stress / pressure. - Constant Training. - Full and immediate availability . - Wireless High-Speed Internet , a minimum of 1 Mega, quality and uncut , you are able to make a video without any problem and clear sound listening . CoreDuo PC or higher with 2 GB of R...
Category: Other - Sales & Marketing       

M****amg
 [?]
Sign in to view client's details.
| M****amg *
|    Spain
Hourly Rate: Not Sure   |  Duration: Not Sure  |  Posted: Apr 14, 2014  |  Ends: 8d, 20h  |   1 Proposal
We are a contact center based on Spain with clients around the world. We focus our activity in e-commerce business. We are looking for commercial agents to help us with our services. ESSENTIAL HIGH LEVEL OF ENGLISH Functions: - Phone sales of different products or services. - Business Track, negotiation and closing. - Report daily tracking service. Requirements: ? Education: Engineering Business Administration and Business Management, Marketing or other studies to commercial sale. ? Essential: - Minimum of 1-3 years in sales. - Experience in customer service. - Advanced user of internet and office. - Good spelling , respecting punctuation , accents and tildes. Excellent grammar. - Proactive , ability to thrive under stress / pressure. - Constant Training. - Full and immediate availability . - Wireless High-Speed Internet , a minimum of 1 Mega, quality and uncut , you are able to make a video without any problem and clear sound listening . CoreDuo PC or higher with 2 GB of RAM o...
Category: Other - Sales & Marketing       
Skills: Advertising, Internet Marketing, Sales, English       

M****amg
 [?]
Sign in to view client's details.
| M****amg *
|    Spain
Hourly Rate: Not Sure   |  Duration: Not Sure  |  Posted: Apr 14, 2014  |  Ends: 8d, 20h  |   1 Proposal
We are a contact center based on Spain with clients around the world. We focus our activity in e-commerce business. We are looking for executive commercial agents to help us with our services. ESSENTIAL HIGH LEVEL OF FRENCH Functions: - Phone sales of different products or services. - Business Track, negotiation and closing. - Report daily tracking service. Requirements: ? Education: Engineering Business Administration and Business Management, Marketing or other studies to commercial sale. ? Essential: - Minimum of 1-3 years in sales. - Experience in customer service. - Advanced user of internet and office. - Good spelling , respecting punctuation , accents and tildes. Excellent grammar. - Proactive , ability to thrive under stress / pressure. - Constant Training. - Full and immediate availability . - Wireless High-Speed Internet , a minimum of 1 Mega, quality and uncut , you are able to make a video without any problem and clear sound listening . CoreDuo PC or higher with 2 G...
Category: Other - Sales & Marketing       
Skills: Advertising, Internet Marketing, Sales, French       

M****amg
 [?]
Sign in to view client's details.
| M****amg *
|    Spain
Hourly Rate: Not Sure   |  Duration: Not Sure  |  Posted: Apr 14, 2014  |  Ends: 8d, 20h  |   0 Proposals
We are a contact center based on Spain with clients around the world. We focus our activity in e-commerce business. We are looking for commercial agents to help us with our services. ESSENTIAL HIGH LEVEL OF GERMAN Functions: - Phone sales of different products or services. - Business Track, negotiation and closing. - Report daily tracking service. Requirements: ? Education: Engineering Business Administration and Business Management, Marketing or other studies to commercial sale. ? Essential: - Minimum of 1-3 years in sales. - Experience in customer service. - Advanced user of internet and office. - Good spelling , respecting punctuation , accents and tildes. Excellent grammar. - Proactive , ability to thrive under stress / pressure. - Constant Training. - Full and immediate availability . - Wireless High-Speed Internet , a minimum of 1 Mega, quality and uncut , you are able to make a video without any problem and clear sound listening . CoreDuo PC or higher with 2 GB of RAM o...
Category: Other - Sales & Marketing       
Skills: Advertising, Internet Marketing, Sales, German       

M****amg
 [?]
Sign in to view client's details.
| M****amg *
|    Spain
Hourly Rate: Not Sure   |  Duration: Not Sure  |  Posted: Apr 14, 2014  |  Ends: 8d, 20h  |   3 Proposals
We are a contact center based on Spain with clients around the world. We focus our activity in e-commerce business. We are looking for commercial agents to help us with our services. ESSENTIAL HIGH LEVEL OF ITALIAN Functions: - Phone sales of different products or services. - Business Track, negotiation and closing. - Report daily tracking service. Requirements: ? Education: Engineering Business Administration and Business Management, Marketing or other studies to commercial sale. ? Essential: - Minimum of 1-3 years in sales. - Experience in customer service. - Advanced user of internet and office. - Good spelling , respecting punctuation , accents and tildes. Excellent grammar. - Proactive , ability to thrive under stress / pressure. - Constant Training. - Full and immediate availability . - Wireless High-Speed Internet , a minimum of 1 Mega, quality and uncut , you are able to make a video without any problem and clear sound listening . CoreDuo PC or higher with 2 GB of RAM o...
Category: Other - Sales & Marketing       
Skills: Advertising, Internet Marketing, Sales, Italian       

M****amg
 [?]
Sign in to view client's details.
| M****amg *
|    Spain
Fixed Price: $500 - $1,000   |  Posted: Apr 13, 2014  |  Ends: 8d, 12h  |   19 Proposals
Develop a mobile app for IOS. Device will be connected to phone using bluetooth. APP needs to be able to sync data into a server to allow a community to share their data and achievements, establish "challenges". Basic functions of the device are heart rate sensor, temperature, blood oxygen level, accelerometer and gyroscope. Hence the APP will need to have an appropriate UI to cater for these sensors, plus sleep pattern analysis, calorie expenditure, workout zone, baseline heart rate, target heart rate, goal settings, achievements, and see other user's profile in the community. Bidders need to produce a proposal on the data flow, upon awarded, produce the UI design. Note that animated UI of the information charts such as dashboard or bar graph etc, are preferred to make the APP more "lively". API will be sent to individual bidders.
Category: Mobile Applications       
Skills: Android, iOS 7       

E****sia
 [?]
Sign in to view client's details.
| E****sia
Fixed Price: Less than $500   |  Posted: Apr 13, 2014  |  Ends: 23d, 12h  |   12 Proposals
I am in need of someone who can provide illustrations for the mobile gaming concept. The game itself is a pattern based game where players swipe through a variation of colored dots. The design is view of an iphone or basic smartphone in the left hand of the user with the right index finger pointing towards the device and swiping across the phone screen to illustrate the game play. These illustrations are basically schematic drawing for demonstration purposes.and need to include the following: 1. The logo for the product onscreen, which I will provide. 2. A black tunnel interface with red grid lines onscreen; practically a tunnel grid. 3. The right finger tapping on the screen, which then displays a 4x4 pattern of dots. Some are colored grey while the rest are red, white, or black. There will also be a ":03", which is how many seconds the player is given to swipe through the pattern. (See the attachment) 4. The right finger swiping through the multicolored pattern ...
Category: Illustration       
Preferred Location: North America

D****teW
 [?]
Sign in to view client's details.
| D****teW *
|    United States
Hourly Rate: Not Sure   |  Duration: 4-6 months  |  Posted: Apr 13, 2014  |  Ends: 8d, 9h  |   66 Proposals
I am seeking an experienced C# .NET WPF developer to help build a Azure driven (or similar) database app. This app was previously developed in a prototyping language. This has the potential to be an on-going project with additional sections added in different phases. The app is? A database app that does time-tracking, manages projects, schedules, employees and invoicing. Generates clean reports of the data. The developed app should? -Follow all best practices for the C# language and .NET framework -Follow the MVVM development pattern, and all related best practices -Use Entity Framework Code First Model (or similar) -Use a style definition file and reference it in all XAML files to modify control appearance from a central point -Use unit tests to verify functionality and assist development -Generate PDF reports that utilize charts, graphs, custom layouts You should? -Be very comfortable with C# and the .NET framework -Be able to rapidly develop and modify the app -Consider attentio...
Category: Software Application       
Skills: .NET Framework, C#, PDF, WPF       

d****ign
 [?]
Sign in to view client's details.
| d****ign
|    United States
Hourly Rate: Not Sure   |  Duration: Not Sure  |  Posted: Apr 13, 2014  |  Ends: 8d, 5h  |   2 Proposals
Hi, I'm looking to hire someone to create detailed patterns and produce a prototype of our new pram/childrens blanket. I've produced a very brief specification (attached) but need a pattern maker, seamstress to use their initiative in making a product practical and simple to reproduce. The blanket needs to roll up and fit into an attached integral bag, on which there will be two straps that can be fastened around a pram handle with poppers. It's essential that our freelancer is creative and able to challenge our thinking as well as the design. We have created our own fabric pattern and will provide all materials in discussion with the Freelancer. Thanks, Nigel
Category: Other - Design       
Preferred Location: United Kingdom

n****216
 [?]
Sign in to view client's details.
| n****216
|    United Kingdom
Symbol Key
Payment method not yet verified
Payment verified
Purchased $1-$500
Purchased $500-$5,000
Purchased more than $5,000
You have already submitted a
proposal to this job